kapa htp library preparation kit (Roche)
Roche manufactures this product 
99
Structured Review
Roche
kapa htp library preparation kit
Kapa Htp Library Preparation Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kapa+htp+library+preparation+kit/KAPA+RNA+Kit/pm41064934-44-7-12
Average 99 stars, based on 1 article reviews
Kapa Htp Library Preparation Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/kapa+htp+library+preparation+kit/KAPA+RNA+Kit/pm41064934-44-7-12
Average 99 stars, based on 1 article reviews
kapa htp library preparation kit - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Construct:Article Title: Genomic and Transcriptional Profiling of Chinese Melanoma Patients Enhanced Potentially Druggable Targets: A Multicenter Study Article Snippet: DNA fragments of 200~400 bp were purified by an Agencourt AMPure XP Kit (Beckman Coulter, CA, USA). .. Fragmented genomic DNA libraries were constructed with the Article Title: Genomic and Transcriptional Profiling of Chinese Melanoma Patients Enhanced Potentially Druggable Targets: A Multicenter Study Article Snippet: Qualified RNA was used to synthesize double-stranded cDNA using a SuperScript VILO cDNA Synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) and an Abclonal Second Strand Synthesis Module (Abclonal, Wuhan, China) according to the recommended protocol. .. To prepare genomic libraries, the double-stranded cDNA was fragmented and constructed by a Amplification:Article Title: Identification of MET fusions in solid tumors: A multicenter, large scale study in China. Article Snippet: Department of Digestive Oncology, Cancer Center, Shanxi Bethune Hospital, Shanxi Academy of Medical Sciences, Tongji Shanxi Hospital, Third Hospital of Shanxi Medical University, Taiyuan, Shanxi, China Jichenjunchuang Clinical Laboratory, Hangzhou, China Department of Gynecologic Oncology, Cancer Hospital of the University of Chinese Academy of Sciences, Zhejiang Cancer Hospital, Hangzhou, China Key Laboratory of Gastroenterology of Zhejiang Province, Zhejiang Provincial People's Hospital, People's Hospital of Hangzhou Medical College, Hangzhou, China Zhejiang Provincial People's Hospital, Hangzhou, China Department of Neurosurgery, Xiangya Hospital Central South University, Changsha, China Adapter Ligation:Article Title: Systematic perturbation screens decode regulators of inflammatory macrophage states and identify a role for TNF mRNA m6A modification Article Snippet: From the estimated 3 to 6 million cells in each of these bins, 20 to 40 % of genomic DNA was recovered by mass. sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG) and reverse (TCTACTATTCTTTCCCCTGCACTGT) primers representing complimentary guide flanking sequences. .. Adapter ligation and indexing PCR was performed on these amplicons using Polymerase Chain Reaction:Article Title: Systematic perturbation screens decode regulators of inflammatory macrophage states and identify a role for TNF mRNA m6A modification Article Snippet: From the estimated 3 to 6 million cells in each of these bins, 20 to 40 % of genomic DNA was recovered by mass. sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG) and reverse (TCTACTATTCTTTCCCCTGCACTGT) primers representing complimentary guide flanking sequences. .. Adapter ligation and indexing PCR was performed on these amplicons using Multiplexing:Article Title: Systematic perturbation screens decode regulators of inflammatory macrophage states and identify a role for TNF mRNA m6A modification Article Snippet: From the estimated 3 to 6 million cells in each of these bins, 20 to 40 % of genomic DNA was recovered by mass. sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG) and reverse (TCTACTATTCTTTCCCCTGCACTGT) primers representing complimentary guide flanking sequences. .. Adapter ligation and indexing PCR was performed on these amplicons using Sequencing:Article Title: Systematic perturbation screens decode regulators of inflammatory macrophage states and identify a role for TNF mRNA m6A modification Article Snippet: From the estimated 3 to 6 million cells in each of these bins, 20 to 40 % of genomic DNA was recovered by mass. sgRNA guide sequences were recovered as amplicons generated by PCR of the genomic DNA using Phusion High-Fidelity PCR Master Mix with GC Buffer (M0531L, NEB) with forward (TCTTGTGGAAAGGACGAGGTACCG) and reverse (TCTACTATTCTTTCCCCTGCACTGT) primers representing complimentary guide flanking sequences. .. Adapter ligation and indexing PCR was performed on these amplicons using Article Title: Molecular profiling in paediatric hepatocellular adenomas: phenotypic correlations and clinical significance. Article Snippet: Yan Zhou, Antonio R Perez-Atayde, Xuchen Zhang, Allison F O’Neill, Alanna J Church & Juan Putra Department of Pathology, Boston Children’s Hospital/Harvard Medical School, Boston, Massachusetts, Department of Pathology, Yale University School of Medicine, New Haven, Connecticut and Dana-Farber Cancer Institute/Boston Children’s Cancer and Blood Disorders Center and Harvard Medical School, Department of Pediatric Oncology, Boston, Massachusetts, USA Next-Generation Sequencing:Article Title: Somatic RIT1 delins in arteriovenous malformations hyperactivate RAS-MAPK signaling amenable to MEK inhibition. Article Snippet: Indexed sequencing libraries were prepared from 50-ng sonically sheared DNA samples using Illumina TruSeq LT reagents (Illumina). .. Extracted DNA underwent targeted NGS using the Article Title: Molecular profiling in paediatric hepatocellular adenomas: phenotypic correlations and clinical significance. Article Snippet: Yan Zhou, Antonio R Perez-Atayde, Xuchen Zhang, Allison F O’Neill, Alanna J Church & Juan Putra Department of Pathology, Boston Children’s Hospital/Harvard Medical School, Boston, Massachusetts, Department of Pathology, Yale University School of Medicine, New Haven, Connecticut and Dana-Farber Cancer Institute/Boston Children’s Cancer and Blood Disorders Center and Harvard Medical School, Department of Pediatric Oncology, Boston, Massachusetts, USA |